View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4148_low_20 (Length: 272)
Name: NF4148_low_20
Description: NF4148
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4148_low_20 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 235; Significance: 1e-130; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 235; E-Value: 1e-130
Query Start/End: Original strand, 18 - 261
Target Start/End: Original strand, 443479 - 443724
Alignment:
| Q |
18 |
tgtgggagctttaccag--gaaagtgtggtttgatgaaaaaacagcaaatgcaatttgcaccgctatggggtatcattcgttttctttgtttggttacat |
115 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
443479 |
tgtgggagctttaccagaggaaagtgtggtttgatgaaaaaacagcaaatgcaatttgcaccgctatggggtatcattcgttttctttgtttggttacat |
443578 |
T |
 |
| Q |
116 |
gcatgttttaaaatcttaccttaggtagtttaagcctaattatgattatgtatttttatttcttaggatcaagacagaagctttatcttttctacttgag |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
443579 |
gcatgttttaaaatcttaccttaggtagtttaagcctaattatgattatgtatttttatttcttaggatcaagacagaagctttatcttttctacttgag |
443678 |
T |
 |
| Q |
216 |
aacaagaagcagattatagaaattgatgattcagacagtgatgatg |
261 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
443679 |
aacaagaagcagattatagaaattgatgattcagacagtgatgatg |
443724 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 37 - 79
Target Start/End: Complemental strand, 465421 - 465379
Alignment:
| Q |
37 |
aagtgtggtttgatgaaaaaacagcaaatgcaatttgcaccgc |
79 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
465421 |
aagtgtggtttgatgaaaaaacagcaaatgcaatttgcaccgc |
465379 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 33 - 76
Target Start/End: Original strand, 444711 - 444754
Alignment:
| Q |
33 |
aggaaagtgtggtttgatgaaaaaacagcaaatgcaatttgcac |
76 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
444711 |
aggaaagtgtggtttgatgaaaaaacagcaaatgctatttgcac |
444754 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University