View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4148_low_32 (Length: 236)
Name: NF4148_low_32
Description: NF4148
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4148_low_32 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 47; Significance: 6e-18; HSPs: 8)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 140 - 218
Target Start/End: Complemental strand, 38934948 - 38934870
Alignment:
| Q |
140 |
gtggtggttgtgatcgaaccttaaaccttgcatatattatgcattgtctttaacatttgagttatggagtactatttac |
218 |
Q |
| |
|
|||| ||||||| |||||||||||||||||||||||||||||||||||| ||| | ||||||| | |||||||||||| |
|
|
| T |
38934948 |
gtggcggttgtgttcgaaccttaaaccttgcatatattatgcattgtctctaataactgagttaagaagtactatttac |
38934870 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 153 - 191
Target Start/End: Complemental strand, 6520128 - 6520090
Alignment:
| Q |
153 |
tcgaaccttaaaccttgcatatattatgcattgtcttta |
191 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
6520128 |
tcgaacctcaaaccttgcatatattatgcattgtcttta |
6520090 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 82 - 115
Target Start/End: Complemental strand, 38934990 - 38934957
Alignment:
| Q |
82 |
taaatgttaattattatgttaatatgttattgac |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
38934990 |
taaatgttaattattatgttaatatgttattgac |
38934957 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 153 - 200
Target Start/End: Original strand, 21266886 - 21266933
Alignment:
| Q |
153 |
tcgaaccttaaaccttgcatatattatgcattgtctttaacatttgag |
200 |
Q |
| |
|
||||||| ||||||| ||||||||||||||||||||||||| ||||| |
|
|
| T |
21266886 |
tcgaaccccaaaccttacatatattatgcattgtctttaacaattgag |
21266933 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #5
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 156 - 191
Target Start/End: Original strand, 43183000 - 43183035
Alignment:
| Q |
156 |
aaccttaaaccttgcatatattatgcattgtcttta |
191 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||| |
|
|
| T |
43183000 |
aaccttagaccttgcatatattatgcattgtcttta |
43183035 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #6
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 155 - 188
Target Start/End: Complemental strand, 41521009 - 41520976
Alignment:
| Q |
155 |
gaaccttaaaccttgcatatattatgcattgtct |
188 |
Q |
| |
|
||||||| |||||||||||||||||||||||||| |
|
|
| T |
41521009 |
gaaccttgaaccttgcatatattatgcattgtct |
41520976 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #7
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 155 - 187
Target Start/End: Complemental strand, 35823431 - 35823399
Alignment:
| Q |
155 |
gaaccttaaaccttgcatatattatgcattgtc |
187 |
Q |
| |
|
||||||||||||||||||||||||||| ||||| |
|
|
| T |
35823431 |
gaaccttaaaccttgcatatattatgccttgtc |
35823399 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #8
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 151 - 191
Target Start/End: Original strand, 46409483 - 46409523
Alignment:
| Q |
151 |
gatcgaaccttaaaccttgcatatattatgcattgtcttta |
191 |
Q |
| |
|
||||||||| | ||| ||||||||||||||||||||||||| |
|
|
| T |
46409483 |
gatcgaaccctgaactttgcatatattatgcattgtcttta |
46409523 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 33; Significance: 0.000000001; HSPs: 5)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 153 - 189
Target Start/End: Original strand, 5702182 - 5702218
Alignment:
| Q |
153 |
tcgaaccttaaaccttgcatatattatgcattgtctt |
189 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||| |
|
|
| T |
5702182 |
tcgaacctcaaaccttgcatatattatgcattgtctt |
5702218 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 153 - 187
Target Start/End: Complemental strand, 2453870 - 2453836
Alignment:
| Q |
153 |
tcgaaccttaaaccttgcatatattatgcattgtc |
187 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||| |
|
|
| T |
2453870 |
tcgaaccctaaaccttgcatatattatgcattgtc |
2453836 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 153 - 187
Target Start/End: Complemental strand, 30200883 - 30200849
Alignment:
| Q |
153 |
tcgaaccttaaaccttgcatatattatgcattgtc |
187 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||| |
|
|
| T |
30200883 |
tcgaacctcaaaccttgcatatattatgcattgtc |
30200849 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 163 - 191
Target Start/End: Complemental strand, 2662139 - 2662111
Alignment:
| Q |
163 |
aaccttgcatatattatgcattgtcttta |
191 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
2662139 |
aaccttgcatatattatgcattgtcttta |
2662111 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #5
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 155 - 187
Target Start/End: Complemental strand, 10594732 - 10594700
Alignment:
| Q |
155 |
gaaccttaaaccttgcatatattatgcattgtc |
187 |
Q |
| |
|
||||| ||||||||||||||||||||||||||| |
|
|
| T |
10594732 |
gaaccctaaaccttgcatatattatgcattgtc |
10594700 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 32; Significance: 0.000000005; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 156 - 191
Target Start/End: Original strand, 28046185 - 28046220
Alignment:
| Q |
156 |
aaccttaaaccttgcatatattatgcattgtcttta |
191 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||| |
|
|
| T |
28046185 |
aacctcaaaccttgcatatattatgcattgtcttta |
28046220 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 162 - 191
Target Start/End: Complemental strand, 19554201 - 19554172
Alignment:
| Q |
162 |
aaaccttgcatatattatgcattgtcttta |
191 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
19554201 |
aaaccttgcatatattatgcattgtcttta |
19554172 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 153 - 187
Target Start/End: Original strand, 12910810 - 12910844
Alignment:
| Q |
153 |
tcgaaccttaaaccttgcatatattatgcattgtc |
187 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||| |
|
|
| T |
12910810 |
tcgaaccttagaccttgcatatattatgcattgtc |
12910844 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 31; Significance: 0.00000002; HSPs: 6)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 153 - 203
Target Start/End: Original strand, 7630180 - 7630230
Alignment:
| Q |
153 |
tcgaaccttaaaccttgcatatattatgcattgtctttaacatttgagtta |
203 |
Q |
| |
|
||||||| || || ||||||||||||||||||||||||| ||| ||||||| |
|
|
| T |
7630180 |
tcgaaccatagacattgcatatattatgcattgtctttagcatctgagtta |
7630230 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 153 - 187
Target Start/End: Original strand, 11844442 - 11844476
Alignment:
| Q |
153 |
tcgaaccttaaaccttgcatatattatgcattgtc |
187 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||| |
|
|
| T |
11844442 |
tcgaaccctaaaccttgcatatattatgcattgtc |
11844476 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 163 - 203
Target Start/End: Original strand, 5246170 - 5246210
Alignment:
| Q |
163 |
aaccttgcatatattatgcattgtctttaacatttgagtta |
203 |
Q |
| |
|
|||||||||||||||||||||||||| || || |||||||| |
|
|
| T |
5246170 |
aaccttgcatatattatgcattgtctataccaattgagtta |
5246210 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 163 - 191
Target Start/End: Complemental strand, 13409475 - 13409447
Alignment:
| Q |
163 |
aaccttgcatatattatgcattgtcttta |
191 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
13409475 |
aaccttgcatatattatgcattgtcttta |
13409447 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #5
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 155 - 191
Target Start/End: Complemental strand, 30893988 - 30893952
Alignment:
| Q |
155 |
gaaccttaaaccttgcatatattatgcattgtcttta |
191 |
Q |
| |
|
|||||| | |||||||||||||||||||||||||||| |
|
|
| T |
30893988 |
gaacctcataccttgcatatattatgcattgtcttta |
30893952 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #6
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 163 - 191
Target Start/End: Complemental strand, 34206274 - 34206246
Alignment:
| Q |
163 |
aaccttgcatatattatgcattgtcttta |
191 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
34206274 |
aaccttgcatatattatgcattgtcttta |
34206246 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 31; Significance: 0.00000002; HSPs: 5)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 153 - 191
Target Start/End: Original strand, 37320521 - 37320559
Alignment:
| Q |
153 |
tcgaaccttaaaccttgcatatattatgcattgtcttta |
191 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
37320521 |
tcgaacctcgaaccttgcatatattatgcattgtcttta |
37320559 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 153 - 194
Target Start/End: Complemental strand, 24393302 - 24393261
Alignment:
| Q |
153 |
tcgaaccttaaaccttgcatatattatgcattgtctttaaca |
194 |
Q |
| |
|
|||||||| | |||||||||||||||||||||||| |||||| |
|
|
| T |
24393302 |
tcgaacctcagaccttgcatatattatgcattgtccttaaca |
24393261 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 155 - 187
Target Start/End: Complemental strand, 4897598 - 4897566
Alignment:
| Q |
155 |
gaaccttaaaccttgcatatattatgcattgtc |
187 |
Q |
| |
|
||||| ||||||||||||||||||||||||||| |
|
|
| T |
4897598 |
gaaccataaaccttgcatatattatgcattgtc |
4897566 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 155 - 187
Target Start/End: Complemental strand, 4944992 - 4944960
Alignment:
| Q |
155 |
gaaccttaaaccttgcatatattatgcattgtc |
187 |
Q |
| |
|
||||| ||||||||||||||||||||||||||| |
|
|
| T |
4944992 |
gaaccataaaccttgcatatattatgcattgtc |
4944960 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #5
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 155 - 187
Target Start/End: Original strand, 40967377 - 40967409
Alignment:
| Q |
155 |
gaaccttaaaccttgcatatattatgcattgtc |
187 |
Q |
| |
|
|||||| |||||||||||||||||||||||||| |
|
|
| T |
40967377 |
gaacctcaaaccttgcatatattatgcattgtc |
40967409 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 30; Significance: 0.00000008; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 154 - 187
Target Start/End: Original strand, 1311807 - 1311840
Alignment:
| Q |
154 |
cgaaccttaaaccttgcatatattatgcattgtc |
187 |
Q |
| |
|
||||||||||||||||||||| |||||||||||| |
|
|
| T |
1311807 |
cgaaccttaaaccttgcatattttatgcattgtc |
1311840 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 155 - 184
Target Start/End: Original strand, 44941419 - 44941448
Alignment:
| Q |
155 |
gaaccttaaaccttgcatatattatgcatt |
184 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
44941419 |
gaaccttaaaccttgcatatattatgcatt |
44941448 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 163 - 191
Target Start/End: Complemental strand, 45425500 - 45425472
Alignment:
| Q |
163 |
aaccttgcatatattatgcattgtcttta |
191 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
45425500 |
aaccttgcatatattatgcattgtcttta |
45425472 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 30; Significance: 0.00000008; HSPs: 4)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 153 - 186
Target Start/End: Complemental strand, 30561780 - 30561747
Alignment:
| Q |
153 |
tcgaaccttaaaccttgcatatattatgcattgt |
186 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||| |
|
|
| T |
30561780 |
tcgaaccttagaccttgcatatattatgcattgt |
30561747 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 153 - 194
Target Start/End: Original strand, 34808567 - 34808608
Alignment:
| Q |
153 |
tcgaaccttaaaccttgcatatattatgcattgtctttaaca |
194 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||| |||||| |
|
|
| T |
34808567 |
tcgaacctcgaaccttgcatatattatgcattgtccttaaca |
34808608 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 155 - 187
Target Start/End: Complemental strand, 35011448 - 35011416
Alignment:
| Q |
155 |
gaaccttaaaccttgcatatattatgcattgtc |
187 |
Q |
| |
|
||||||| ||||||||||||||||||||||||| |
|
|
| T |
35011448 |
gaaccttgaaccttgcatatattatgcattgtc |
35011416 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 155 - 187
Target Start/End: Original strand, 36467031 - 36467063
Alignment:
| Q |
155 |
gaaccttaaaccttgcatatattatgcattgtc |
187 |
Q |
| |
|
|||||||| |||||||||||||||||||||||| |
|
|
| T |
36467031 |
gaaccttataccttgcatatattatgcattgtc |
36467063 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University