View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4148_low_36 (Length: 224)
Name: NF4148_low_36
Description: NF4148
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4148_low_36 |
 | |
|
| [»] scaffold0054 (1 HSPs) |
| | |
|
Alignment Details
Target: chr1 (Bit Score: 193; Significance: 1e-105; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 13 - 209
Target Start/End: Original strand, 34461598 - 34461794
Alignment:
| Q |
13 |
agcacagacagtgtgaagaagcctctcaatgattccatttatggagctcatagtgaatttatggtagccctaaaatatgtcacactcctaactatattct |
112 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34461598 |
agcacatacagtgtgaagaagcctctcaatgattccatttatggagctcatagtgaatttatggtagccctaaaatatgtcacactcctaactatattct |
34461697 |
T |
|
| Q |
113 |
tattctcatttttctgtcacacattgtccattaggtttttcaaccaagtaagcatcctcatttgcacaccacaagatgtcttgtcctatgctgtcat |
209 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34461698 |
tattctcatttttctgtcacacattgtccattaggtttttcaaccaagtaagcatcctcatttgcacaccacaagatgtcttgtcctatgctgtcat |
34461794 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 13 - 122
Target Start/End: Complemental strand, 1149831 - 1149722
Alignment:
| Q |
13 |
agcacagacagtgtgaagaagcctctcaatgattccatttatggagctcatagtgaatttatggtagccctaaaatatgtcacactcctaactatattct |
112 |
Q |
| |
|
|||||| | |||||||| ||||| || |||||| | ||||||||||| ||| ||||||| ||||| || |||||||||||| ||||||| || || ||| |
|
|
| T |
1149831 |
agcacatatagtgtgaaaaagccactaaatgatgcaatttatggagcacatggtgaattcatggttgcactaaaatatgtctcactcctcacaattttcc |
1149732 |
T |
|
| Q |
113 |
tattctcatt |
122 |
Q |
| |
|
| |||||||| |
|
|
| T |
1149731 |
tcttctcatt |
1149722 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0054 (Bit Score: 68; Significance: 2e-30; HSPs: 1)
Name: scaffold0054
Description:
Target: scaffold0054; HSP #1
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 67 - 190
Target Start/End: Original strand, 21638 - 21761
Alignment:
| Q |
67 |
gaatttatggtagccctaaaatatgtcacactcctaactatattcttattctcatttttctgtcacacattgtccattaggtttttcaaccaagtaagca |
166 |
Q |
| |
|
|||||||||| ||||||||||||||| ||||| || || ||||||||||||||||||||||| ||||| | || ||||||||| |||||||| ||||| |
|
|
| T |
21638 |
gaatttatggaagccctaaaatatgtgacacttcttaccatattcttattctcatttttctgccacactctttcaattaggtttctcaaccaattaagcc |
21737 |
T |
|
| Q |
167 |
tcctcatttgcacaccacaagatg |
190 |
Q |
| |
|
|||| ||||||||||||||||||| |
|
|
| T |
21738 |
tccttatttgcacaccacaagatg |
21761 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University