View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4149_high_11 (Length: 282)
Name: NF4149_high_11
Description: NF4149
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4149_high_11 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 215; Significance: 1e-118; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 11 - 267
Target Start/End: Original strand, 39460453 - 39460710
Alignment:
| Q |
11 |
cagagattgttttgttgtatctcatagaaaccggagctaatattgcgatgattgctggatcctgaaaatatatttaattaaaatacctcttctcacttcc |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39460453 |
cagagattgttttgttgtatctcatagaaaccggagctaatattgcgatgattgctggatcctgaaaatatatttaattaaaatacctcttctcacttcc |
39460552 |
T |
 |
| Q |
111 |
tctcccttccgttgaaccaaatggctcctaaaaggccaataaagct-nnnnnnnnntaatcttaaccatgatcatcctccactgagtccacagcggttgg |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| || ||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
39460553 |
tctcccttccgttgaaccaaatggctcctaaaaggccaataaagctaaaaaaaatatattcttaaccatgatcatcctccaccgagtccacagcggttgg |
39460652 |
T |
 |
| Q |
210 |
tttcagagataaatttatgaaattgagaaatgctatgagcaccgtttatggaataaac |
267 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39460653 |
tttcagagataaatttatgaaattgagaaatgctatgagcaccgtttatggaataaac |
39460710 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University