View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4149_high_14 (Length: 212)
Name: NF4149_high_14
Description: NF4149
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4149_high_14 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 131; Significance: 4e-68; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 131; E-Value: 4e-68
Query Start/End: Original strand, 1 - 131
Target Start/End: Original strand, 31162124 - 31162254
Alignment:
| Q |
1 |
attgtacccatagtgatttctagatcgtgatagtgtagagaaggtgattcaaattctaatttccattttatataattcagttccacttactaaaattatt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31162124 |
attgtacccatagtgatttctagatcgtgatagtgtagagaaggtgattcaaattctaatttccattttatataattcagttccacttactaaaattatt |
31162223 |
T |
 |
| Q |
101 |
caaactccaaatgagctttgccacatcatat |
131 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
31162224 |
caaactccaaatgagctttgccacatcatat |
31162254 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 176 - 212
Target Start/End: Original strand, 31162299 - 31162335
Alignment:
| Q |
176 |
ctgaggaccacaaacccaattttagaaagaaaaatga |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31162299 |
ctgaggaccacaaacccaattttagaaagaaaaatga |
31162335 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University