View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4150_high_4 (Length: 262)
Name: NF4150_high_4
Description: NF4150
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4150_high_4 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 10 - 247
Target Start/End: Complemental strand, 32269273 - 32269040
Alignment:
| Q |
10 |
aacaatatacaagaggcaccataaatatgcggccacctcccaaaaggctaaaccacctaagataaactccaaaggaataaaatagcaccatggaggaaaa |
109 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
32269273 |
aacaaaatacaagaggcaccataaatatgcggccaccccccaaaaggctaaaccacctaagataaactccaaaggaataaaatagcac----gaggaaaa |
32269178 |
T |
|
| Q |
110 |
aacttaaaaacacccataaccaagaaactgtctcaataagcactttgagttccaacaccattcatggaataaacaagatgatatcttaatttattcaaac |
209 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
32269177 |
aacttaaaaacacccataaccaagaaactgtctcaataagcactttgagttccaacaccattcatagaataaacaagatgatatcttaatttattcaaac |
32269078 |
T |
|
| Q |
210 |
ttcaatcccaaaacaccaccataatttcctttacaatt |
247 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
32269077 |
ttcaatcccaaaacaccaccataatttcctctacaatt |
32269040 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University