View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4150_low_4 (Length: 263)
Name: NF4150_low_4
Description: NF4150
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4150_low_4 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 122; Significance: 1e-62; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 122; E-Value: 1e-62
Query Start/End: Original strand, 108 - 246
Target Start/End: Complemental strand, 17167516 - 17167376
Alignment:
| Q |
108 |
tagcaatgatatcgatgcaggcaggaacgagaaggaagaccgagagacaacaacggcacaaaccacactctc--tgtgcgtgtggcgggaagagtccctc |
205 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
17167516 |
tagcaatgatatcgatgcaggcaggagtgagaaggaagaccgagagacaacaacggcacaaaccacactctcgctgtgcgtgtggcgggaagagtccctc |
17167417 |
T |
 |
| Q |
206 |
ggtgtctgttcctgaggttttgatacaaaacacataaacca |
246 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17167416 |
ggtgtctgttcctgaggttttgatacaaaacacataaacca |
17167376 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 50 - 93
Target Start/End: Complemental strand, 17167575 - 17167532
Alignment:
| Q |
50 |
tctatctttatcataaattgcagagtaatagagtaaatttgaat |
93 |
Q |
| |
|
|||||||||||||||| || ||||||||||||||||||||||| |
|
|
| T |
17167575 |
tctatctttatcataagatgaagagtaatagagtaaatttgaat |
17167532 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University