View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4150_low_6 (Length: 249)
Name: NF4150_low_6
Description: NF4150
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4150_low_6 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 1 - 230
Target Start/End: Complemental strand, 34274570 - 34274336
Alignment:
| Q |
1 |
attgaagatgtgaaatttaacgtgcatgtaatggtggt---agtagaagaaagggagagagaca--ttacctgtagagagaaatggaatagagaggcgag |
95 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||| ||||||||||||||||||||| | |||||||||||||||||||||||||||||||||| |
|
|
| T |
34274570 |
attgaagatgtgaaattcaacgtgcatgtaatggtggtggtagtagaagaaagggagagagagacgttacctgtagagagaaatggaatagagaggcgag |
34274471 |
T |
 |
| Q |
96 |
ggttgatgataacagctgcgcggcgggagggtaatgagaagtgaaatatgaagttaaacttttatagataaaaggaaaacctagtattgtgtgtgtgaga |
195 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34274470 |
ggttgatgataatagctgcgcggcgggagggtaatgagaagtgaaatatgaagttaaacttttatagataaaaggaaaacctagtattgtgtgtgtgaga |
34274371 |
T |
 |
| Q |
196 |
atcgtgaaacaaggaaactatttgcatgttcacgt |
230 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||| |
|
|
| T |
34274370 |
atcgtgaaacaagcaaactatttgcatgttcacgt |
34274336 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University