View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4151_high_10 (Length: 244)
Name: NF4151_high_10
Description: NF4151
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4151_high_10 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 225; Significance: 1e-124; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 225; E-Value: 1e-124
Query Start/End: Original strand, 1 - 225
Target Start/End: Complemental strand, 45935885 - 45935661
Alignment:
| Q |
1 |
cattcagttttattagtgtctttctttccagcaagaatccttgaaatctgaagtcctctactacatgcttgattgaatagcaaccgggtttggaactccg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45935885 |
cattcagttttattagtgtctttctttccagcaagaatccttgaaatctgaagtcctctactacatgcttgattgaatagcaaccgggtttggaactccg |
45935786 |
T |
 |
| Q |
101 |
acacaaatgggaaccatgataaaactgctgctggcatgaaaattatcaaccccattacatattcatatgctcttgaaagttctctcactgaagcccatag |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45935785 |
acacaaatgggaaccatgataaaactgctgctggcatgaaaattatcaaccccattacatattcatatgctcttgaaagttctctcactgaagcccatag |
45935686 |
T |
 |
| Q |
201 |
tttagcccacttcaagagtcccctg |
225 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
45935685 |
tttagcccacttcaagagtcccctg |
45935661 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 188; Significance: 1e-102; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 1 - 224
Target Start/End: Complemental strand, 15817966 - 15817743
Alignment:
| Q |
1 |
cattcagttttattagtgtctttctttccagcaagaatccttgaaatctgaagtcctctactacatgcttgattgaatagcaaccgggtttggaactccg |
100 |
Q |
| |
|
||||||||||| | ||||||||||||||||||||||||| ||||||||||||||||||||||| |||||||||||||||||||||| ||||||||||||| |
|
|
| T |
15817966 |
cattcagttttgtaagtgtctttctttccagcaagaatcattgaaatctgaagtcctctactaaatgcttgattgaatagcaaccgcgtttggaactccg |
15817867 |
T |
 |
| Q |
101 |
acacaaatgggaaccatgataaaactgctgctggcatgaaaattatcaaccccattacatattcatatgctcttgaaagttctctcactgaagcccatag |
200 |
Q |
| |
|
|||||||||||||||| ||||||||||||| |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15817866 |
acacaaatgggaaccacgataaaactgctgttggcatgaaaattatcaatcccattacatattcatatgctcttgaaagttctctcactgaagcccatag |
15817767 |
T |
 |
| Q |
201 |
tttagcccacttcaagagtcccct |
224 |
Q |
| |
|
||| |||||||||||||||||||| |
|
|
| T |
15817766 |
tttcgcccacttcaagagtcccct |
15817743 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 49 - 118
Target Start/End: Original strand, 43953280 - 43953349
Alignment:
| Q |
49 |
tgaagtcctctactacatgcttgattgaatagcaaccgggtttggaactccgacacaaatgggaaccatg |
118 |
Q |
| |
|
||||||||||| || ||||||| |||||||||| || ||||||||| || || |||||||||||||||| |
|
|
| T |
43953280 |
tgaagtcctctgctgaatgcttggttgaatagcagcctggtttggaattctgaaacaaatgggaaccatg |
43953349 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University