View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4151_low_15 (Length: 220)
Name: NF4151_low_15
Description: NF4151
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4151_low_15 |
 | |
|
| [»] scaffold0705 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0705 (Bit Score: 159; Significance: 8e-85; HSPs: 1)
Name: scaffold0705
Description:
Target: scaffold0705; HSP #1
Raw Score: 159; E-Value: 8e-85
Query Start/End: Original strand, 18 - 211
Target Start/End: Complemental strand, 6977 - 6787
Alignment:
| Q |
18 |
tcaaaagcaaataccgtaactattaaggaaattgctatttctgttatacattcaataatttgcaagttattggcttgattgacttttaaaattgttttta |
117 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6977 |
tcaaaagcaaatacaataactattaaggaaattgctatttctgttata-attcaataatttgcaagttattggcttgattgacttttaaaattgttttta |
6879 |
T |
|
| Q |
118 |
aaagagatcagtactgacgcttgaatcaaaagagttttgattctgtctcgttttaaattgatatgttatcaatttgagatttctctgtgctgct |
211 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| ||||||| |
|
|
| T |
6878 |
a--gagatcagtactgacgcttgaatcaaaagagttttgattctgtctcgttttaaattgatatggtatcaatttgagatttctctatgctgct |
6787 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 159; Significance: 8e-85; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 159; E-Value: 8e-85
Query Start/End: Original strand, 18 - 211
Target Start/End: Complemental strand, 15355924 - 15355734
Alignment:
| Q |
18 |
tcaaaagcaaataccgtaactattaaggaaattgctatttctgttatacattcaataatttgcaagttattggcttgattgacttttaaaattgttttta |
117 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15355924 |
tcaaaagcaaatacaataactattaaggaaattgctatttctgttata-attcaataatttgcaagttattggcttgattgacttttaaaattgttttta |
15355826 |
T |
|
| Q |
118 |
aaagagatcagtactgacgcttgaatcaaaagagttttgattctgtctcgttttaaattgatatgttatcaatttgagatttctctgtgctgct |
211 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| ||||||| |
|
|
| T |
15355825 |
a--gagatcagtactgacgcttgaatcaaaagagttttgattctgtctcgttttaaattgatatggtatcaatttgagatttctctatgctgct |
15355734 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University