View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4151_low_5 (Length: 398)
Name: NF4151_low_5
Description: NF4151
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4151_low_5 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 210; Significance: 1e-115; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 150 - 386
Target Start/End: Original strand, 46836433 - 46836670
Alignment:
| Q |
150 |
tccacagtacgtggatatgggagagtgcacgtgtcttgtcctgatttgtagttttgttatggtgttctcaacagatatcacaaagccaaaagcgcggttt |
249 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46836433 |
tccacagtacgtggatatgggagagtgcacgtgtcctgtcctgatttgtagctttgttatggtgttctcaacagatatcacaaagccaaaagcgcggttt |
46836532 |
T |
|
| Q |
250 |
tgtattccaacctgaacgctttaaggtcaccttcttcttccattgaaatcacatgtttgg-aaattcattttggttagtactcattgttcatcattttac |
348 |
Q |
| |
|
|| ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46836533 |
tggattccaacctgaacgctctaaggtcaccttcttcttccattgaaatcacatgtttggaaaattcattttggttagtactcattgttcatcattttac |
46836632 |
T |
|
| Q |
349 |
cctatgatccttgtttttacaccgacaccttatccctt |
386 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
46836633 |
cctatgatccttgtttttacactgacaccttatccctt |
46836670 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 75; E-Value: 2e-34
Query Start/End: Original strand, 18 - 96
Target Start/End: Original strand, 46836305 - 46836383
Alignment:
| Q |
18 |
ataatatcataccaggttaaataagcagatgtaagttttgtcactttgacaaatatactataactacttgatgatagtg |
96 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46836305 |
ataatagcataccaggttaaataagcagatgtaagttttgtcactttgacaaatatactataactacttgatgatagtg |
46836383 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University