View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4151_low_8 (Length: 287)
Name: NF4151_low_8
Description: NF4151
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4151_low_8 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 239; Significance: 1e-132; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 239; E-Value: 1e-132
Query Start/End: Original strand, 20 - 278
Target Start/End: Original strand, 52609620 - 52609878
Alignment:
| Q |
20 |
cataatgactgtgtcggttaattatgttttttgagttgtcgctttgtatcgcgcgtgaggacactcgtcaaaggatgtttgatgaaggtgtgatatttgc |
119 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52609620 |
cataatgactgtgtcggctaattatgttttttgagttgtcgctttgtatcgcccgtgaggacactcgtcaaaggatgtttgatgaaggtgtgatatttgc |
52609719 |
T |
|
| Q |
120 |
gagtgcgtttgtttgtggcaaaggttgggattattgaattttatgttaatatgtaatttgtcgatttaaggagaatgaatcacatttttcagatttattg |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
52609720 |
gagtgcgtttgtttgtggcaaaggttgggattattgaattttatgtcaatatgtaatttgtcgatttaaggagaatgaatcacattttccagatttattg |
52609819 |
T |
|
| Q |
220 |
tatattgtatataagtgtggatcttgccttctaagtgaatttttgtttttctttcttct |
278 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
52609820 |
tatattgtatataagtgtggatcttgccttctaagtgagtttttgtttttctttcttct |
52609878 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University