View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4152_high_4 (Length: 244)
Name: NF4152_high_4
Description: NF4152
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4152_high_4 |
 |  |
|
| [»] chr1 (2 HSPs) |
 |  |
|
| [»] chr4 (2 HSPs) |
 |  |
|
| [»] chr5 (3 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 120; Significance: 2e-61; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 120; E-Value: 2e-61
Query Start/End: Original strand, 73 - 244
Target Start/End: Original strand, 6871083 - 6871253
Alignment:
| Q |
73 |
tgtcaagtattatgggacggagggagtatcaaataacaacaacacatttgataacacgaggttcaagttgtaaaattctagttagcatgtggttnnnnnn |
172 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
6871083 |
tgtcaagtattatgggacggagggagtatcaaataacaacaacacatttgataacacgaggttcaagttgtaaaactctagttagcatgtggttgggggt |
6871182 |
T |
 |
| Q |
173 |
nnnnnnattgggacgttgggtagcttaattggtttgagttaagggataaggacttggatatcctgggttcaa |
244 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
6871183 |
gggggg-ttgggacgttgggtagcttaattggtttgagttaagggataaggacttggatgtcctgggttcaa |
6871253 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 187 - 244
Target Start/End: Complemental strand, 36472710 - 36472653
Alignment:
| Q |
187 |
gttgggtagcttaattggtttgagttaagggataaggacttggatatcctgggttcaa |
244 |
Q |
| |
|
||||||||||| || |||| |||| ||||||||||||| ||||| |||||||||||| |
|
|
| T |
36472710 |
gttgggtagctcaactggtctgagctaagggataaggagttggaggtcctgggttcaa |
36472653 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 37; Significance: 0.000000000005; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 188 - 244
Target Start/End: Original strand, 8456805 - 8456861
Alignment:
| Q |
188 |
ttgggtagcttaattggtttgagttaagggataaggacttggatatcctgggttcaa |
244 |
Q |
| |
|
|||||||||| || ||||||||| ||||||||||||| |||||| |||||||||||| |
|
|
| T |
8456805 |
ttgggtagctcaactggtttgagctaagggataaggagttggatgtcctgggttcaa |
8456861 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 73 - 109
Target Start/End: Complemental strand, 4271843 - 4271807
Alignment:
| Q |
73 |
tgtcaagtattatgggacggagggagtatcaaataac |
109 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
4271843 |
tgtcaagtattatgggacggagggagtattaaataac |
4271807 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 34; Significance: 0.0000000003; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 187 - 244
Target Start/End: Original strand, 6296852 - 6296909
Alignment:
| Q |
187 |
gttgggtagcttaattggtttgagttaagggataaggacttggatatcctgggttcaa |
244 |
Q |
| |
|
||||||||||| |||||||||||| ||||||||||||| ||||| | |||||||||| |
|
|
| T |
6296852 |
gttgggtagctcaattggtttgagctaagggataaggagttggaggttctgggttcaa |
6296909 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 187 - 244
Target Start/End: Complemental strand, 29815023 - 29814966
Alignment:
| Q |
187 |
gttgggtagcttaattggtttgagttaagggataaggacttggatatcctgggttcaa |
244 |
Q |
| |
|
||||||||||| |||||||||||| ||||||||||||| ||||| |||| ||||||| |
|
|
| T |
29815023 |
gttgggtagctcaattggtttgagctaagggataaggagttggaggtcctaggttcaa |
29814966 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 187 - 244
Target Start/End: Complemental strand, 10635407 - 10635350
Alignment:
| Q |
187 |
gttgggtagcttaattggtttgagttaagggataaggacttggatatcctgggttcaa |
244 |
Q |
| |
|
||||||||||| || ||||||||| ||||||||||||| ||||| |||||| ||||| |
|
|
| T |
10635407 |
gttgggtagctcaactggtttgagctaagggataaggagttggaggtcctggcttcaa |
10635350 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 32; Significance: 0.000000005; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 181 - 224
Target Start/End: Original strand, 18069272 - 18069315
Alignment:
| Q |
181 |
tgggacgttgggtagcttaattggtttgagttaagggataagga |
224 |
Q |
| |
|
||||| ||||||||||| ||||| |||||||||||||||||||| |
|
|
| T |
18069272 |
tgggaagttgggtagctcaattgatttgagttaagggataagga |
18069315 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 202 - 244
Target Start/End: Original strand, 12020073 - 12020115
Alignment:
| Q |
202 |
tggtttgagttaagggataaggacttggatatcctgggttcaa |
244 |
Q |
| |
|
||||||||||||||||||||||| ||||| |||||||||||| |
|
|
| T |
12020073 |
tggtttgagttaagggataaggagttggaggtcctgggttcaa |
12020115 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University