View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4152_low_3 (Length: 271)
Name: NF4152_low_3
Description: NF4152
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4152_low_3 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 179; Significance: 1e-96; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 179; E-Value: 1e-96
Query Start/End: Original strand, 11 - 193
Target Start/End: Original strand, 48579966 - 48580148
Alignment:
| Q |
11 |
caaaggtgttgaagtgtgctggtagagttttgaaaaagtagattcatattcgaataatccaccgccatggaatatgactaaacagagttgttgggtttgt |
110 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
48579966 |
caaaggtgttgaagtgtgctggtagagttttgaaaaagtagattcatattcgaataatccaccgccatggaatatgactaaacagagctgttgggtttgt |
48580065 |
T |
 |
| Q |
111 |
gagagatggtgatggtgatggtgatgtctttgggtgtgtagtgaatatgggttgtctagattgggtagtattacagtcatggc |
193 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48580066 |
gagagatggtgatggtgatggtgatgtctttgggtgtgtagtgaatatgggttgtctagattgggtagtattacagtcatggc |
48580148 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 39; Significance: 0.0000000000004; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 119 - 157
Target Start/End: Original strand, 47030104 - 47030142
Alignment:
| Q |
119 |
gtgatggtgatggtgatgtctttgggtgtgtagtgaata |
157 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47030104 |
gtgatggtgatggtgatgtctttgggtgtgtagtgaata |
47030142 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University