View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4154_high_16 (Length: 350)
Name: NF4154_high_16
Description: NF4154
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4154_high_16 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 316; Significance: 1e-178; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 316; E-Value: 1e-178
Query Start/End: Original strand, 19 - 342
Target Start/End: Complemental strand, 3864924 - 3864601
Alignment:
| Q |
19 |
gatcatggtgacggagaaccgtttgacggagtattaggggttttagcgcatgctttttcaccacaaaatggaaggttccatttagatgcagctgaaaact |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3864924 |
gatcatggtgacggagaaccgtttgacggagtattaggggttttagcgcatgctttttcaccacaaaatggaaggttccatttagatgcagctgaaaact |
3864825 |
T |
 |
| Q |
119 |
gggccgttgattttaatcatgatgattcaagggtagccgttgatttggaatcagttgcaacacacgagataggtcacgtgcttggtttgggtcattcgtc |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3864824 |
gggccgttgattttaatcatgatgattcaagggtagccgttgatttggaatcagttgcaacacacgagataggtcacgtgcttggtttgggtcattcgtc |
3864725 |
T |
 |
| Q |
219 |
tataaaagaagcggttatgtacccgaatttgagtccgagaaggaaaaaggttgacttgaaaattgatgacgtggaaggtgttcaatctctttacgggtct |
318 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
3864724 |
tataaaagaagcggttatgtacccgaatttgagtccgagaaggaaaaaagttgacttgaaaattgatgacgtggaaggtgttcaatctctctacgggtct |
3864625 |
T |
 |
| Q |
319 |
aacccgaatttcactttcagttct |
342 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
3864624 |
aacccgaatttcactttcagttct |
3864601 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University