View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4154_high_30 (Length: 265)
Name: NF4154_high_30
Description: NF4154
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4154_high_30 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 241; Significance: 1e-133; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 241; E-Value: 1e-133
Query Start/End: Original strand, 5 - 265
Target Start/End: Complemental strand, 45847367 - 45847107
Alignment:
| Q |
5 |
gagcagcacagacccttaatactatacaaactgtgactattgtctaaaatatcacttttggattatcctttaccctcgtgtcttttagcatatgcgtaag |
104 |
Q |
| |
|
||||| ||| |||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45847367 |
gagcaacactgacccttaatactatacaaactgtgactattgtctaaaatttcacttttggattatcctttaccctcgtgtcttttagcatatgcgtaag |
45847268 |
T |
 |
| Q |
105 |
ttaaaatttataatcatttggttttttctttcattggagaacttgatttttgaattaccaagaacaaaagaaaaaacaaacaaatttctaacgcctctaa |
204 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45847267 |
ttaaaatttataatcatttgattttttctttcattggagaactttatttttgaattaccaagaacaaaagaaaaaacaaacaaatttctaacgcctctaa |
45847168 |
T |
 |
| Q |
205 |
atcttccaaatttgatttggcccctcgtcatgaaatcaaatcatttgttatatttgaatat |
265 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45847167 |
atcttccaaatttgatttggcccctcgtcatgaaatcaaatcatttgttatatttgaatat |
45847107 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University