View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4154_high_35 (Length: 250)
Name: NF4154_high_35
Description: NF4154
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4154_high_35 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 71; Significance: 3e-32; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 166 - 240
Target Start/End: Complemental strand, 27580927 - 27580853
Alignment:
| Q |
166 |
gtccaacttggcgcttcacataataactagattgcccacagtattttcacacaaaaaacttgtttgttttctgtg |
240 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
27580927 |
gtccaacttggcgcttcacataataactagattgcccacagtattttcacacaaaaaacttctttgttttctgtg |
27580853 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 138 - 167
Target Start/End: Complemental strand, 27580968 - 27580939
Alignment:
| Q |
138 |
atgtaagacactagtttgaatcatgcatgt |
167 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
27580968 |
atgtaagacactagtttgaatcatgcatgt |
27580939 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University