View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4154_high_44 (Length: 237)
Name: NF4154_high_44
Description: NF4154
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4154_high_44 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 146; Significance: 5e-77; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 146; E-Value: 5e-77
Query Start/End: Original strand, 53 - 223
Target Start/End: Complemental strand, 14745292 - 14745118
Alignment:
| Q |
53 |
tttacagtgaaaggtatatctgaattaaatcaaaataaaaaatgatggttcaagagttttgctttctcatccaatatg----gtaactgcagtctagtct |
148 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||| |||||||||| |
|
|
| T |
14745292 |
tttacagtgaaaggtatatctgaattaaatcaaaataaaaaatgatggttcaagagttttgctttctcatgcaatatgcatggtaactgtagtctagtct |
14745193 |
T |
|
| Q |
149 |
acctcacttgaaaagcaagccattttggaggttgcccctaagatagcacaagttctgcaccaagacactgataat |
223 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
14745192 |
acctcacttgaaaagcaagccattttggaggttgcccctaagatagcacaacttctgcaccaagacactgataat |
14745118 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 96; Significance: 3e-47; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 96; E-Value: 3e-47
Query Start/End: Original strand, 11 - 139
Target Start/End: Original strand, 17582033 - 17582161
Alignment:
| Q |
11 |
catcatcaaactgttacgattgactgtcggtatnnnnnnntgtttacagtgaaaggtatatctgaattaaatcaaaataaaaaatgatggttcaagagtt |
110 |
Q |
| |
|
|||||||||||||||||||||||| |||| ||| |||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
17582033 |
catcatcaaactgttacgattgaccgtcgttataaaaaaatgtttacagtgaaaggtatatctgaattaaatcaaaataaaaaatgatagttcaagagtt |
17582132 |
T |
|
| Q |
111 |
ttgctttctcatccaatatggtaactgca |
139 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
17582133 |
ttgctttctcatccaatatggtaactgca |
17582161 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 168 - 223
Target Start/End: Original strand, 17582163 - 17582218
Alignment:
| Q |
168 |
ccattttggaggttgcccctaagatagcacaagttctgcaccaagacactgataat |
223 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17582163 |
ccattttggaggttgcccctaagatagcacaagttctgcaccaagacactgataat |
17582218 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 57 - 85
Target Start/End: Original strand, 53896417 - 53896445
Alignment:
| Q |
57 |
cagtgaaaggtatatctgaattaaatcaa |
85 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
53896417 |
cagtgaaaggtatatctgaattaaatcaa |
53896445 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University