View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4154_high_56 (Length: 211)
Name: NF4154_high_56
Description: NF4154
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4154_high_56 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 185; Significance: 1e-100; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 1 - 202
Target Start/End: Complemental strand, 37337052 - 37336849
Alignment:
| Q |
1 |
ccaaatgagggaatgaagaaaaagatgtatggtatgagagaagaaggagacagtaaatggtttgcgtaaaaaacactcaaaatttggaaagagcagggag |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37337052 |
ccaaatgagggaatgaagaaaaagatgtatggtatgagagaagaaggagacagtaaatggtttgcgtaaaaaacactcaaaatttggaaagagcagggag |
37336953 |
T |
 |
| Q |
101 |
gaagaaaataaatgtgcatctcctcactcgtggggtgaaaattaaataacaagattcattt--gttttagaggaaactaacaagattcattattcatctc |
198 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| || |
|
|
| T |
37336952 |
gaagaaaataaatgtgcatctcctcactcgtggggtgaaaattaaataacaagattcattttatttttagaggaaactaacaagattcattattcatttc |
37336853 |
T |
 |
| Q |
199 |
actc |
202 |
Q |
| |
|
|||| |
|
|
| T |
37336852 |
actc |
37336849 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University