View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4154_low_30 (Length: 286)
Name: NF4154_low_30
Description: NF4154
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4154_low_30 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 116; Significance: 5e-59; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 116; E-Value: 5e-59
Query Start/End: Original strand, 18 - 137
Target Start/End: Original strand, 38868985 - 38869104
Alignment:
| Q |
18 |
gaaacacgccttttacttcatggagaaacccaattccagattttagaactggaagtgtgattccatgttcgtttgccatggaaactgcttagtaaacaac |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38868985 |
gaaacacgccttttacttcatggagaaacccaattccagattttagaactggaagtgcgattccatgttcgtttgccatggaaactgcttagtaaacaac |
38869084 |
T |
 |
| Q |
118 |
gataagaaaccgatcctaaa |
137 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
38869085 |
gataagaaaccgatcctaaa |
38869104 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 27 - 99
Target Start/End: Complemental strand, 39046650 - 39046578
Alignment:
| Q |
27 |
cttttacttcatggagaaacccaattccagattttagaactggaagtgtgattccatgttcgtttgccatgga |
99 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||| |||||||| ||| ||| ||| ||| ||||||||||| |
|
|
| T |
39046650 |
cttttacttcatggagaaaccctattccagattttgcaactggaaatgttatttcattttcatttgccatgga |
39046578 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 60; Significance: 1e-25; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 28 - 99
Target Start/End: Original strand, 33468861 - 33468932
Alignment:
| Q |
28 |
ttttacttcatggagaaacccaattccagattttagaactggaagtgtgattccatgttcgtttgccatgga |
99 |
Q |
| |
|
||||||||||||||||||||| ||| |||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
33468861 |
ttttacttcatggagaaaccctatttcagattttagaactggaagtgtgattccatgttcgttttccatgga |
33468932 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 32; Significance: 0.000000006; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 255 - 286
Target Start/End: Original strand, 1032988 - 1033019
Alignment:
| Q |
255 |
gtgttcgggttcgaactccgacccctgcatat |
286 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
1032988 |
gtgttcgggttcgaactccgacccctgcatat |
1033019 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University