View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4154_low_31 (Length: 280)
Name: NF4154_low_31
Description: NF4154
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4154_low_31 |
 | |
|
| [»] chr5 (2 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 220; Significance: 1e-121; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 16 - 280
Target Start/End: Complemental strand, 36354472 - 36354203
Alignment:
| Q |
16 |
atatgatcccaatttcttagtatcacacagacacaaaccgaaactaatgcattctagttgnnnnnnncatccttgattttctcttcttcacacgttttgg |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
36354472 |
atatgatcccaatttcttagtatcacacagacacaaaccgaaactaatgcattctagttgtttttttcatccttgattttctcttcttcacacgttttgg |
36354373 |
T |
|
| Q |
116 |
tcgacctcgac----agcattgtggcatcttcctattggacaaca-tttagattataacatttttatatccgaaatatccttacttcattaacaggaaca |
210 |
Q |
| |
|
||||||||||| |||||||||||||| ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36354372 |
tcgacctcgacgtacagcattgtggcatcctcctattggacaacactttagattataacatttttatatccgaaatatccttacttcattaacaggaaca |
36354273 |
T |
|
| Q |
211 |
atttccatatctatggcaagatacaacaatagctactatttctgggaatatttttctttcccagttcatc |
280 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36354272 |
atttccatatctatggcaagatacaacaatagctactatttctgggaatatttttctttcccagttcatc |
36354203 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 212 - 280
Target Start/End: Complemental strand, 36355557 - 36355489
Alignment:
| Q |
212 |
tttccatatctatggcaagatacaacaatagctactatttctgggaatatttttctttcccagttcatc |
280 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||| | |||||| |||| ||| ||||| |||||| |
|
|
| T |
36355557 |
tttccatatctatggccagatacaacaatagctactactcttgggaaaatttctctatcccaattcatc |
36355489 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University