View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4154_low_36 (Length: 253)
Name: NF4154_low_36
Description: NF4154
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4154_low_36 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 207; Significance: 1e-113; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 1 - 244
Target Start/End: Complemental strand, 38666301 - 38666050
Alignment:
| Q |
1 |
cttgctcttaacaagactgagcttgtcgataaagaggtttgttatgttgccataatgacgttgtgattatgattatgtgttcatttagtgta-------- |
92 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38666301 |
cttgctcttaacaagactgagcttgtcgataaagaggtttgttatgttgccataatgacgttgtgattatgattatgtgttcatttagtgtagaagtgta |
38666202 |
T |
|
| Q |
93 |
tactaaggttagatgaaaattgtggtaggttagattagaccaatgttggatgtgcttatatctaataagagttaaggccaatttggataacctgttgaat |
192 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
38666201 |
tactaaggttagatgaaaattgtggtaggttagattagaccaatgttggatgtgcttatagctaataagagttaaggccaatttggataaccggttgaat |
38666102 |
T |
|
| Q |
193 |
taagcacatgtaacataagggtgcattttattggcaaaacaacaagtattat |
244 |
Q |
| |
|
|||||| ||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
38666101 |
taagcatatgtaacataagggtgcattttattcgcaaaacaacaagtattat |
38666050 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University