View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4154_low_41 (Length: 248)
Name: NF4154_low_41
Description: NF4154
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4154_low_41 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 231; Significance: 1e-128; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 231; E-Value: 1e-128
Query Start/End: Original strand, 4 - 242
Target Start/End: Original strand, 32259223 - 32259461
Alignment:
| Q |
4 |
acatttaattaattggtttgatattgatctatcaatggaggagaccttacgaggcaacggaaatgtctcactttcatttaattcccagggggtgttgaaa |
103 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32259223 |
acatttaattaattggtttgatattgatctatcaatggaggagaccttacgaggcaacggaaatgtctcactttcatttaattcccagggggtgttgaaa |
32259322 |
T |
|
| Q |
104 |
atttgtgtaaaaaatgatagaaatgttggctcttatggcattttttctggagataatccatttgatttcactcttccggcaacattgttccaaatcatcg |
203 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
32259323 |
atttgtgtaaaaaatgatagaaatgttggctcttatggcattttttctggagataatccattcgatttcactcttccggcaacattgttccaaatcatca |
32259422 |
T |
|
| Q |
204 |
ttattgtcgtcctctctcaaactctttactttcttctca |
242 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32259423 |
ttattgtcgtcctctctcaaactctttactttcttctca |
32259461 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University