View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4154_low_46 (Length: 239)
Name: NF4154_low_46
Description: NF4154
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4154_low_46 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 210; Significance: 1e-115; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 1 - 222
Target Start/End: Complemental strand, 32812552 - 32812331
Alignment:
| Q |
1 |
tactctctcggcaatggaggattcaatcttgaacgtatgtcaacagcatatagtatagttgatgacctgttaggatcatacagtccagataacgctttgc |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |||||||||||||||| |
|
|
| T |
32812552 |
tactctctcggcaatggaggattcaatcttgaacgtatgtcaacagcatatagtatagttgatgacctgttaggatcatacggcccagataacgctttgc |
32812453 |
T |
 |
| Q |
101 |
atctccatagatgtgtggtgattacattaaaactagtgacacgggcaatactattaacttttgctttttccttcagtttgttgatatttttagaggttaa |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32812452 |
atctccatagatgtgtggtgattacattaaaactagtgacacgggcaatactattaatttttgctttttccttcagtttgttgatatttttagaggttaa |
32812353 |
T |
 |
| Q |
201 |
ttgaaaaaccttaaagtcgagt |
222 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
32812352 |
ttgaaaaaccttaaagtcgagt |
32812331 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 5 - 185
Target Start/End: Complemental strand, 32830078 - 32829898
Alignment:
| Q |
5 |
ctctcggcaatggaggattcaatcttgaacgtatgtcaacagcatatagtatagttgatgacctgttaggatcatacagtccagataacgctttgcatct |
104 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||| ||||||| ||| | ||||| || ||||||||||| | ||| || ||||| ||||| |
|
|
| T |
32830078 |
ctctcggcaatggaggattcaatcttgaacgtatatcaaccgcatataaaataatagatgatctattaggatcatatgatttagacaatgctttacatct |
32829979 |
T |
 |
| Q |
105 |
ccatagatgtgtggtgattacattaaaactagtgacacgggcaatactattaacttttgctttttccttcagtttgttgat |
185 |
Q |
| |
|
||||| ||||| || || ||||||||||| ||||||| | | ||||| ||||||| |||||||| || |||||||| |
|
|
| T |
32829978 |
ccatatatgtgcggcgacaacattaaaactgatgacacgagaggtgttattaccttttgccttttccttaaggttgttgat |
32829898 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University