View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4154_low_56 (Length: 219)
Name: NF4154_low_56
Description: NF4154
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4154_low_56 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 182; Significance: 1e-98; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 182; E-Value: 1e-98
Query Start/End: Original strand, 20 - 205
Target Start/End: Original strand, 45142189 - 45142374
Alignment:
| Q |
20 |
aaatatcctacattctgtttctaagtttgttgtaaatttggaatgcgttcctactattagaaaggaaagccttgtaattcttgatcatagtgatgagatc |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45142189 |
aaatatcctacattctgtttctaagtttgttgtaaatttggaatgcgttcctactattagaaaggaaagccttgtaattcttgatcatagtgatgagatc |
45142288 |
T |
|
| Q |
120 |
gacctcagtgaggatgtaggattcaaattgatccaaacatcgtgttttcatctttactttctgtaatcttttattttgtgtctgtg |
205 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
45142289 |
gacctcagtgaggatgtaggattcaaattgatccaaacatcgtgttttcatctttactttctgtaatcttttattttgtgtgtgtg |
45142374 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 110 - 161
Target Start/End: Complemental strand, 34530995 - 34530943
Alignment:
| Q |
110 |
tgatgagatcgacctcagtgaggatgtaggattcaaa-ttgatccaaacatcg |
161 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||| |||||||||| |||| |
|
|
| T |
34530995 |
tgatgagatcgacctcaacgaggatgtaggattcaaagttgatccaaatatcg |
34530943 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 32; Significance: 0.000000005; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 99 - 134
Target Start/End: Complemental strand, 29361487 - 29361452
Alignment:
| Q |
99 |
cttgatcatagtgatgagatcgacctcagtgaggat |
134 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||| |
|
|
| T |
29361487 |
cttgatcatagtgatgggatcgacctcagtgaggat |
29361452 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 99 - 134
Target Start/End: Original strand, 30270623 - 30270658
Alignment:
| Q |
99 |
cttgatcatagtgatgagatcgacctcagtgaggat |
134 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||| |
|
|
| T |
30270623 |
cttgatcatagtgatgggatcgacctcagtgaggat |
30270658 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University