View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4155_high_22 (Length: 219)
Name: NF4155_high_22
Description: NF4155
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4155_high_22 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 195; Significance: 1e-106; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 1 - 203
Target Start/End: Original strand, 5543327 - 5543528
Alignment:
| Q |
1 |
agcacatgttcctgcaactattaccgcaatcattatatgaaattaaaccaccttttatgctacacaacccgaccgtaattgtggtcacatttcagcgcga |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5543327 |
agcacatgttcctgcaactattaccgcaatcattatatgaaattaaaccaccttttatgctacacaacccgaccgtaattgtggtcacatttcagcgcga |
5543426 |
T |
 |
| Q |
101 |
ttctttataatatcaaagattgtgacgtgactgtacatgttactgcaactattaccgcgatcattatttaaaactttgaccttaggtttgtggagacatg |
200 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5543427 |
ttctttat-atatcaaagattgtgacgtgactgtacatgttactgcaactattaccgcgatcattatttaaaactttgaccttaggtttgtggagacatg |
5543525 |
T |
 |
| Q |
201 |
tgg |
203 |
Q |
| |
|
||| |
|
|
| T |
5543526 |
tgg |
5543528 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 100; E-Value: 1e-49
Query Start/End: Original strand, 40 - 167
Target Start/End: Original strand, 5543235 - 5543362
Alignment:
| Q |
40 |
aaattaaaccaccttttatgctacacaacccgaccgtaattgtggtcacatttcagcgcgattctttataatatcaaagattgtgacgtgactgtacatg |
139 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||||||||||||||| | ||||| |
|
|
| T |
5543235 |
aaattaaaccaccttttatgttacacaacccgaccataattgtggtcacatttcagcgcgattctctataatatcaaagattgtgacgtgacagcacatg |
5543334 |
T |
 |
| Q |
140 |
ttactgcaactattaccgcgatcattat |
167 |
Q |
| |
|
|| |||||||||||||||| |||||||| |
|
|
| T |
5543335 |
ttcctgcaactattaccgcaatcattat |
5543362 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University