View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4155_low_15 (Length: 320)
Name: NF4155_low_15
Description: NF4155
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4155_low_15 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 173; Significance: 5e-93; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 173; E-Value: 5e-93
Query Start/End: Original strand, 15 - 296
Target Start/End: Complemental strand, 44897138 - 44896868
Alignment:
| Q |
15 |
tcaacaagttctatatctacaggaacttcttcaatttcatcaattcccattatctttctctcttacacacaatgtccttgnnnnnnnnnnnnnnnnngtg |
114 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| ||| |
|
|
| T |
44897138 |
tcaacaagttctatatctacaggaacttcttcaatttcatcaattcccattatctgtctctcttacacacaatgtccttgtttttgttttt------gtg |
44897045 |
T |
 |
| Q |
115 |
acatccattccatgcctctgtctcttcgtcttttaaaagcaattgcatgttactattgtggtcnnnnnnnatgttacatttgggtcaacgtagaggatat |
214 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |||||||||||||| |
|
|
| T |
44897044 |
acatccat-----gcctctgtctcttcgtcttttaaaagcaattgcatgttactattgtggtctttttttatgttacatttgggttaacgtagaggatat |
44896950 |
T |
 |
| Q |
215 |
caaattccaggaaactacatgggactgtgggaattctctcagctgttttggaacgaactgaagctcaatttctagatgttag |
296 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
44896949 |
caaattccaggaaactacatgggactgtgggaattctctcagctgttttggaacgaagtgaagctcaatttctagatgttag |
44896868 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University