View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4155_low_17 (Length: 298)
Name: NF4155_low_17
Description: NF4155
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4155_low_17 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 169; Significance: 1e-90; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 169; E-Value: 1e-90
Query Start/End: Original strand, 70 - 281
Target Start/End: Original strand, 28833629 - 28833841
Alignment:
| Q |
70 |
cctcaaacaatctttgacatgataacttgctacctaagggacagtaaaaatttaactctcaaataagtattaaatgatgaaagaaacactaaagccaaat |
169 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
28833629 |
cctcaaacaatctttgacatgataacttgctacctaagggacagtaaaaatttaactctcaaataagtattaaatgatgaaagaaatactaaagccaaat |
28833728 |
T |
 |
| Q |
170 |
tatataaagtgtgaacatattgct-nnnnnnnngtttgctcatatcaacacactaatttactatttaattttagacttgaccttataatatatgattagc |
268 |
Q |
| |
|
|||||||||||||| ||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28833729 |
tatataaagtgtgatcatattgctaaaaaaaaagtttggtcatatcaacacactaatttactatttaattttagacttgaccttataatatatgattagc |
28833828 |
T |
 |
| Q |
269 |
ataaagtcacaag |
281 |
Q |
| |
|
||||||||||||| |
|
|
| T |
28833829 |
ataaagtcacaag |
28833841 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 1 - 48
Target Start/End: Original strand, 28833591 - 28833638
Alignment:
| Q |
1 |
atacgatgtttttcaagtttacttttagcaagttttaacctcaaacaa |
48 |
Q |
| |
|
||||||||||||||||||||| |||| ||||||||||||||||||||| |
|
|
| T |
28833591 |
atacgatgtttttcaagtttagtttttgcaagttttaacctcaaacaa |
28833638 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University