View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4155_low_28 (Length: 203)
Name: NF4155_low_28
Description: NF4155
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4155_low_28 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 125; Significance: 1e-64; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 125; E-Value: 1e-64
Query Start/End: Original strand, 14 - 189
Target Start/End: Complemental strand, 43259229 - 43259052
Alignment:
| Q |
14 |
atataccaagctggtggttatttt--gctagcagttnnnnnnntatgattactatcttattacatgaataaattattgttaactatcttttttaatatga |
111 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43259229 |
atataccaagctggtggttattttttgctagcagttaaaaaaatatgattactatcttattacatgaataaattattgttaactatcttttttaatatga |
43259130 |
T |
 |
| Q |
112 |
ctgaagttagatatgcttttaacaatccacatctacttctaaatgagtcgagtcatnnnnnnncaacgttgctatatg |
189 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
43259129 |
ctgaagttagatatgcttttaacaatccacatctacttctaaatgagtcgagtcataaaaaaacaacgttgctatatg |
43259052 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University