View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4156_high_4 (Length: 334)
Name: NF4156_high_4
Description: NF4156
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4156_high_4 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 303; Significance: 1e-170; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 303; E-Value: 1e-170
Query Start/End: Original strand, 18 - 324
Target Start/End: Original strand, 43082010 - 43082316
Alignment:
| Q |
18 |
atgaacaccatcccaattaatatactgagaagggctagtgcagacagtagcattaggtgtaccacaagtttcaaacacagtgaagttgtaaggaggttct |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43082010 |
atgaacaccatcccaattaatatactgagaagggctagtgcagacagtagcattaggtgtaccacaagtttcaaacacagtgaagttgtaaggaggttct |
43082109 |
T |
 |
| Q |
118 |
cctgatccacagcagacactgaacacatctttgaatccatacttgcttggattcttcatcacagtacggtaggcattgaagtaatcagcataaactatga |
217 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43082110 |
cctgatccacagcagacactgaacaaatctttgaatccatacttgcttggattcttcatcacagtacggtaggcattgaagtaatcagcataaactatga |
43082209 |
T |
 |
| Q |
218 |
ctgcatgtggatactgtttcctgaattcttgtaatctagcttgcagcataaggttgtgattgttgcttaggtcattagcacttttcacacaccctaagtc |
317 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43082210 |
ctgcatgtggatactgtttcctgaattcttgtaatctagcttgcagcataaggttgtgattgttgcttaggtcattagcacttttcacacaccctaagtc |
43082309 |
T |
 |
| Q |
318 |
gtctctg |
324 |
Q |
| |
|
||||||| |
|
|
| T |
43082310 |
gtctctg |
43082316 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University