View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4156_low_6 (Length: 250)
Name: NF4156_low_6
Description: NF4156
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4156_low_6 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 65; Significance: 1e-28; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 123 - 233
Target Start/End: Original strand, 42965760 - 42965866
Alignment:
| Q |
123 |
atgcaagataacgatttttagttacggatgagtaaatgttttcaaattatgctagatttatttagcagtannnnnnnaaaagaaaaattcaagtgaatag |
222 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| ||| ||||||||||| |||||||||||| |||||||||| |
|
|
| T |
42965760 |
atgcaagataacgatttttagttacggatgagtaaatgttttcaaattatgttag----atttagcagtatttttttaaaagaaaaattgaagtgaatag |
42965855 |
T |
|
| Q |
223 |
atgttacctca |
233 |
Q |
| |
|
||||||||||| |
|
|
| T |
42965856 |
atgttacctca |
42965866 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 1 - 45
Target Start/End: Original strand, 42965639 - 42965683
Alignment:
| Q |
1 |
tttttattggcttactgaatgctatagaatggatactctaaccca |
45 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42965639 |
tttttattggcttactgaatgctatagaatggatactctaaccca |
42965683 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University