View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4157_high_15 (Length: 249)
Name: NF4157_high_15
Description: NF4157
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4157_high_15 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 157; Significance: 1e-83; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 157; E-Value: 1e-83
Query Start/End: Original strand, 1 - 192
Target Start/End: Complemental strand, 17381506 - 17381318
Alignment:
| Q |
1 |
ccaaaggccttggacagatgggaacaaagattaactgatgtttttgaaggacgtccttatgatatgtatgatgctgcactttcagatactgtcacaaagt |
100 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
17381506 |
ccaaaggctttggacagatgggaacaaagattaactgatgtttttgaaggacgtccttatgatatgtatgatgctgcactttcagatacagtcacaaagt |
17381407 |
T |
 |
| Q |
101 |
accctgttgatatacaggtaggttacaaccacatgcccaaaattgaagtgtgaaatttaacctttctataccttcaaattggaataaaatta |
192 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||| |||||||||||||||||||| ||||||||||||||||| |||||| |
|
|
| T |
17381406 |
accctgttgatatacaggtaggttacaatcacatgcccaaaattg-agtgtgaaatttaacctttc--taccttcaaattggaattaaatta |
17381318 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 202 - 242
Target Start/End: Complemental strand, 17381267 - 17381227
Alignment:
| Q |
202 |
gaatatgtttgcttaacattaggtaaaattgatttcatctc |
242 |
Q |
| |
|
|||||||||||| || |||||||||||||||||||||||| |
|
|
| T |
17381267 |
gaatatgtttgcaaaaaattaggtaaaattgatttcatctc |
17381227 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 42; Significance: 0.000000000000006; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 7 - 120
Target Start/End: Complemental strand, 39524426 - 39524313
Alignment:
| Q |
7 |
gccttggacagatgggaacaaagattaactgatgtttttgaaggacgtccttatgatatgtatgatgctgcactttcagatactgtcacaaagtaccctg |
106 |
Q |
| |
|
||||||||||||||||| ||| | |||||||||||||||||| | || || |||||||||| ||||||||| || ||| | |||| | |||||||| | |
|
|
| T |
39524426 |
gccttggacagatgggagcaacggttaactgatgtttttgaatgtcgaccatatgatatgtttgatgctgctctctcactcagtgtctctaagtaccccg |
39524327 |
T |
 |
| Q |
107 |
ttgatatacaggta |
120 |
Q |
| |
|
||||||| |||||| |
|
|
| T |
39524326 |
ttgatattcaggta |
39524313 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University