View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4157_high_18 (Length: 240)
Name: NF4157_high_18
Description: NF4157
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4157_high_18 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 155; Significance: 2e-82; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 155; E-Value: 2e-82
Query Start/End: Original strand, 25 - 240
Target Start/End: Original strand, 16919933 - 16920148
Alignment:
| Q |
25 |
ccatttgttgtatgtgtccaaaccagatcatcttctatctcctgcatagggatggaaactttatgaacaaggttccaaacatttggaaagtccgttgaga |
124 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |||||||| ||||| |||| ||||||||| ||||||| |
|
|
| T |
16919933 |
ccatttgttgtatgtgtccaaaccagatcatcttctatctcctgcatagggatggtaactttgtgaacaagattccatacatctggaaagtcagttgaga |
16920032 |
T |
|
| Q |
125 |
actcaggaggaaggttccagcaattgtcttgaatgtaatcactgactaaaatactttgatcaacgacttcattagtcnnnnnnngattgaaaggttgacc |
224 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||| |||||||||||| |||||| ||||||||| |
|
|
| T |
16920033 |
actcaggaggaaggttccagcaattgtcatgaatgtaatcactgaccaaaatactttgatcaacaacttcattagtcaaaaaaagattgagaggttgacc |
16920132 |
T |
|
| Q |
225 |
acaccattgatcagac |
240 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
16920133 |
acaccattgatcagac |
16920148 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University