View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4157_low_14 (Length: 250)
Name: NF4157_low_14
Description: NF4157
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4157_low_14 |
 |  |
|
| [»] scaffold0401 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr4 (Bit Score: 213; Significance: 1e-117; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 1 - 237
Target Start/End: Original strand, 16920212 - 16920448
Alignment:
| Q |
1 |
tcattttttatgctagaccagattgatgaagagatgtgatgagaaataattcttctccctctcaagactctactaggaataagagcagcccaatcttctt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| ||||||||| |||||||||||| ||||||||||| |
|
|
| T |
16920212 |
tcattttttatgctagaccagattgatgaagagatgtgatgagaaataattcttctgcctctcaaaactctactaagaataagagcagaccaatcttctt |
16920311 |
T |
 |
| Q |
101 |
tcttatgaaataaatcccaacaaagtttgagatttgctgcttggttgagctttttaagagatctaatccctaaaccaccttgagcagtaggtttacaaat |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
16920312 |
tcttatgaaataaatcccaacaaagtttgagatttgctgcttggttgagctttttaagagatctaatccctaaaccaccttgatcagtaggtttacaaat |
16920411 |
T |
 |
| Q |
201 |
tttcttccaggctacagtgactagtttccttttgtct |
237 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||| |
|
|
| T |
16920412 |
tttcttccaggctacagtgactagtttcctgttgtct |
16920448 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0401 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: scaffold0401
Description:
Target: scaffold0401; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 90 - 128
Target Start/End: Original strand, 13421 - 13459
Alignment:
| Q |
90 |
ccaatcttctttcttatgaaataaatcccaacaaagttt |
128 |
Q |
| |
|
|||||||||||| |||||||| ||||||||||||||||| |
|
|
| T |
13421 |
ccaatcttcttttttatgaaacaaatcccaacaaagttt |
13459 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University