View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4157_low_16 (Length: 249)

Name: NF4157_low_16
Description: NF4157
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF4157_low_16
NF4157_low_16
[»] chr3 (2 HSPs)
chr3 (1-192)||(17381318-17381506)
chr3 (202-242)||(17381227-17381267)
[»] chr5 (1 HSPs)
chr5 (7-120)||(39524313-39524426)


Alignment Details
Target: chr3 (Bit Score: 157; Significance: 1e-83; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 157; E-Value: 1e-83
Query Start/End: Original strand, 1 - 192
Target Start/End: Complemental strand, 17381506 - 17381318
Alignment:
1 ccaaaggccttggacagatgggaacaaagattaactgatgtttttgaaggacgtccttatgatatgtatgatgctgcactttcagatactgtcacaaagt 100  Q
    |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||    
17381506 ccaaaggctttggacagatgggaacaaagattaactgatgtttttgaaggacgtccttatgatatgtatgatgctgcactttcagatacagtcacaaagt 17381407  T
101 accctgttgatatacaggtaggttacaaccacatgcccaaaattgaagtgtgaaatttaacctttctataccttcaaattggaataaaatta 192  Q
    |||||||||||||||||||||||||||| |||||||||||||||| ||||||||||||||||||||  ||||||||||||||||| ||||||    
17381406 accctgttgatatacaggtaggttacaatcacatgcccaaaattg-agtgtgaaatttaacctttc--taccttcaaattggaattaaatta 17381318  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 202 - 242
Target Start/End: Complemental strand, 17381267 - 17381227
Alignment:
202 gaatatgtttgcttaacattaggtaaaattgatttcatctc 242  Q
    ||||||||||||  || ||||||||||||||||||||||||    
17381267 gaatatgtttgcaaaaaattaggtaaaattgatttcatctc 17381227  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 42; Significance: 0.000000000000006; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 7 - 120
Target Start/End: Complemental strand, 39524426 - 39524313
Alignment:
7 gccttggacagatgggaacaaagattaactgatgtttttgaaggacgtccttatgatatgtatgatgctgcactttcagatactgtcacaaagtaccctg 106  Q
    ||||||||||||||||| ||| | |||||||||||||||||| | || || |||||||||| ||||||||| || |||   | |||| | |||||||| |    
39524426 gccttggacagatgggagcaacggttaactgatgtttttgaatgtcgaccatatgatatgtttgatgctgctctctcactcagtgtctctaagtaccccg 39524327  T
107 ttgatatacaggta 120  Q
    ||||||| ||||||    
39524326 ttgatattcaggta 39524313  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University