View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4157_low_18 (Length: 240)
Name: NF4157_low_18
Description: NF4157
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4157_low_18 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 145; Significance: 2e-76; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 145; E-Value: 2e-76
Query Start/End: Original strand, 2 - 221
Target Start/End: Original strand, 26163864 - 26164072
Alignment:
| Q |
2 |
ggaagttagtctgtgtctcactatt----ggtcactctaatttgattagttcacttcagagcttctcaatataagctcattactttattgtgtgaacact |
97 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||| |
|
|
| T |
26163864 |
ggaagttagtctgtgtctcactattaattggtcactctaatttgattagttcacttcagagcttctcaatataagctcattacttcattgtgtaaacact |
26163963 |
T |
 |
| Q |
98 |
ttttcccatcaaatttcagtttaatctcttatcactttgtctcacattacattccctccttcctcaatacgtttcttcatggctttcttaacgaggagtt |
197 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||||||||||||||||||||||||| |
|
|
| T |
26163964 |
ttttcccatcaaatttcagtttaatctcttatcactttgtctcacatta---------------caatacgttgcttcatggctttcttaacgaggagtt |
26164048 |
T |
 |
| Q |
198 |
agcttaggaagtagaaatgcatgc |
221 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
26164049 |
agcttaggaagtagaaatgcatgc |
26164072 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University