View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4157_low_22 (Length: 237)
Name: NF4157_low_22
Description: NF4157
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4157_low_22 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 168; Significance: 4e-90; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 168; E-Value: 4e-90
Query Start/End: Original strand, 1 - 222
Target Start/End: Original strand, 17381686 - 17381903
Alignment:
| Q |
1 |
ttttcttctctcttgagtcatcaattgtgtgcctgagatttgaagatttgatcaattaaggacgaataaaggatagttactaaaaatttgatcaaatgat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17381686 |
ttttcttctctcttgagtcatcaattgtgtgcctgagatttgaagatttgatcaattaaggacgaataaaggatagttactaaaaatttgatcaaatgat |
17381785 |
T |
|
| Q |
101 |
ttctaacatttacacgcactgtcataatgcaagtttgaattgacggccagtttgacataatcacgcttgtgaccgtgtttttgacaatagcttacacttt |
200 |
Q |
| |
|
|||||||| |||| | ||||| |||| ||| ||||||||||||||||||||||||||||||||||| |||||||| ||||||||||| |||||||||||| |
|
|
| T |
17381786 |
ttctaaca-ttacccacactgccatattgccagtttgaattgacggccagtttgacataatcacgcgtgtgaccgcgtttttgacaaaagcttacacttt |
17381884 |
T |
|
| Q |
201 |
agataagcttcaacaaaacacg |
222 |
Q |
| |
|
|| ||||||||||||||||| |
|
|
| T |
17381885 |
ag---agcttcaacaaaacacg |
17381903 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University