View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4160_high_2 (Length: 382)
Name: NF4160_high_2
Description: NF4160
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4160_high_2 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 222; Significance: 1e-122; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 19 - 263
Target Start/End: Original strand, 26840441 - 26840688
Alignment:
| Q |
19 |
tgttttgcttctttaacaattttgcattggtgaggctttagtagcacgcacaaaatgacactacactacaaccacgttgaaaattgctcaacatctcaaa |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26840441 |
tgttttgcttctttaacaattttgcattggtgaggctttagtagcacgcacaaaatgacactacactacaaccacgttgaaaattgctcaacatctcaaa |
26840540 |
T |
 |
| Q |
119 |
gccaagactataaca---gccagcatgtccttttttgtatatgatgattcaaccgttcaaagtctttgaattaacaactttagtttagttcgtaggtttg |
215 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26840541 |
gccaagactataacaacagccagcatgtccttttttgtatatgatgattcaaccgttcaaagtctttgaattaacaactttagtttagttcgtaggtttg |
26840640 |
T |
 |
| Q |
216 |
aacaactgaacacccttatagtaatagaaaactcacctaaaaccggtt |
263 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||| | ||||||||| |
|
|
| T |
26840641 |
aacaactgaacacccttatagtaatagaaagctcacttgaaaccggtt |
26840688 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 97; E-Value: 1e-47
Query Start/End: Original strand, 261 - 373
Target Start/End: Original strand, 26840736 - 26840848
Alignment:
| Q |
261 |
gttcttctacaagtcaatattgtcatttagactcaaaccattctcaaaaatatctgatcatattcattttattctttgtaattccttttactctcgggtg |
360 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| ||||||||||||||||||||||| | |
|
|
| T |
26840736 |
gttcttctacaagtcaatattgtcatttagactcaaaccattctcaaaaatatccgatcatattcattttattcattgtaattccttttactctcgggcg |
26840835 |
T |
 |
| Q |
361 |
cggtgatgatgtc |
373 |
Q |
| |
|
|||| |||||||| |
|
|
| T |
26840836 |
cggttatgatgtc |
26840848 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University