View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4161_high_1_N (Length: 519)
Name: NF4161_high_1_N
Description: NF4161
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4161_high_1_N |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 483; Significance: 0; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 483; E-Value: 0
Query Start/End: Original strand, 1 - 491
Target Start/End: Complemental strand, 869340 - 868850
Alignment:
| Q |
1 |
tctctctcatctggagcttcgaatggacaaccttggcgataatgagattatacatgaaagcccatcaaagttggattgcattggtgcagcagtcaatgtg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
869340 |
tctctctcatctggagcttcgaatggacaaccttggcgataatgagattatacatgaaagcccatcaaagttggattgcattggtgcagcagtcaatgtg |
869241 |
T |
|
| Q |
101 |
gaaactctaaaattgtggggtgtcttgatcaaacttatccctaaatgggaaacgttccataatcttaggatccttgaagttgttggggcaagagtcgagg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
869240 |
gaaactctaaaattgtggggtgtcttgatcaaacttatccctaaatgggaaacgttccataatcttaggatccttgaagttgttggggcaagagtcgagg |
869141 |
T |
|
| Q |
201 |
acgctgcagtaaatgcaatgattcaggcctgtccaaatctgacaaggttactactgcttggatgtgaaggtgtccgatcaatttcgatcaccctgccatt |
300 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
869140 |
atgctgcagtaaatgcaatgattcaggcctgtccaaatctgacaaggttactactgcttggatgtgaaggtgtccgatcaatttcgatcaccctgccatt |
869041 |
T |
|
| Q |
301 |
tttggagcagtgcaagctggatttttatggtcttgggaactgttcactttcactgacctcccctaaaattgaatctcttgaggtacaaggctgtagttgg |
400 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
869040 |
tttggagcagtgcaagctggatttttatggtcttgggaactgttcgctttcactgacctcccctaaaattgaatctcttgaggtacaaggctgtagttgg |
868941 |
T |
|
| Q |
401 |
attagggtccctgaaaccaagcatttgaagaacctttcaatttccaacagtgcaggtagtcgaatgtttcaagtgattcttgtactttcat |
491 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
868940 |
attagggtccctgaaaccaagcatttgaagaacctttcaatttccaacagtgcaggtagtcgaatgtttcaagtgattcttgtactttcat |
868850 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University