View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4162_high_11 (Length: 247)
Name: NF4162_high_11
Description: NF4162
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4162_high_11 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 167; Significance: 1e-89; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 167; E-Value: 1e-89
Query Start/End: Original strand, 32 - 240
Target Start/End: Complemental strand, 31897852 - 31897651
Alignment:
| Q |
32 |
atagatagatactactagacttctctttatcatgggttctattggaattgaaaggtgacacttttacatgttttgtaatttgtactagcatcttcaatct |
131 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |||||||||| | |
|
|
| T |
31897852 |
atagatagatactactagacttcactttatcatgggttctattggaattgagaggtgacacttttacatgttttgtaatttgtactaacatcttcaatgt |
31897753 |
T |
|
| Q |
132 |
tcaatatgtcactgttttttagttaatttcattttcttaatgttgttttttctcttgcagttcaaaaactgaggttgtcactgttgatgtgcttgcaacc |
231 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31897752 |
-------gtcactgttttttagttaatttcattttcttaatgttgttttttctcttgcagttcaaaaactgaggttgtcactgttgatgtgcttgcaacc |
31897660 |
T |
|
| Q |
232 |
aagtctctg |
240 |
Q |
| |
|
||||||||| |
|
|
| T |
31897659 |
aagtctctg |
31897651 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University