View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4162_high_14 (Length: 237)
Name: NF4162_high_14
Description: NF4162
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4162_high_14 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 58; Significance: 2e-24; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 161 - 222
Target Start/End: Complemental strand, 43663055 - 43662994
Alignment:
| Q |
161 |
acctatatatattacctcagatatttgatctggtagttgattcttgctttgatctaccttgt |
222 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
43663055 |
acctatatatattacctcagatatttgatctggtagttgattcttgctatgatctaccttgt |
43662994 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 1 - 40
Target Start/End: Complemental strand, 43663205 - 43663166
Alignment:
| Q |
1 |
gttgagctattacactagagcatatgaaagagatagatga |
40 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43663205 |
gttgagctattacactagagcatatgaaagagatagatga |
43663166 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University