View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4162_high_14 (Length: 237)

Name: NF4162_high_14
Description: NF4162
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF4162_high_14
NF4162_high_14
[»] chr2 (2 HSPs)
chr2 (161-222)||(43662994-43663055)
chr2 (1-40)||(43663166-43663205)


Alignment Details
Target: chr2 (Bit Score: 58; Significance: 2e-24; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 161 - 222
Target Start/End: Complemental strand, 43663055 - 43662994
Alignment:
161 acctatatatattacctcagatatttgatctggtagttgattcttgctttgatctaccttgt 222  Q
    |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||    
43663055 acctatatatattacctcagatatttgatctggtagttgattcttgctatgatctaccttgt 43662994  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 1 - 40
Target Start/End: Complemental strand, 43663205 - 43663166
Alignment:
1 gttgagctattacactagagcatatgaaagagatagatga 40  Q
    ||||||||||||||||||||||||||||||||||||||||    
43663205 gttgagctattacactagagcatatgaaagagatagatga 43663166  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University