View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4162_high_8 (Length: 253)
Name: NF4162_high_8
Description: NF4162
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4162_high_8 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 215; Significance: 1e-118; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 12 - 247
Target Start/End: Complemental strand, 44452901 - 44452666
Alignment:
| Q |
12 |
agagatgatgacatttactatatgcactaacatcattaaaattgggaaacagttgatttgtcaaaccggaagatttactctcttcagaaccatcttctga |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44452901 |
agagatgatgacatttactatatgcactaacatcattaaaattgggaaacagttgatttgtcaaaccggaagatttactctcttcagaaccatcttctga |
44452802 |
T |
|
| Q |
112 |
ccttgaaacagctgtttatcatcnnnnnnngattgtcaatagaagccagactatgatatatacatatcaagttagtcgactttgccacatgaaaatttca |
211 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44452801 |
ccttgaaacagctgtttatcatcaaaaaaagattgtcaatagaagccagactatgatatatacatatcaagttagtcgactttgccacatgaaaatttca |
44452702 |
T |
|
| Q |
212 |
attgctttatgtagtaatttaacagtttcagttttc |
247 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
44452701 |
attgctttatgtagtaatttaacagtttcagttttc |
44452666 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University