View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4162_low_8 (Length: 301)

Name: NF4162_low_8
Description: NF4162
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF4162_low_8
NF4162_low_8
[»] chr1 (1 HSPs)
chr1 (14-283)||(45888301-45888570)


Alignment Details
Target: chr1 (Bit Score: 266; Significance: 1e-148; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 266; E-Value: 1e-148
Query Start/End: Original strand, 14 - 283
Target Start/End: Original strand, 45888301 - 45888570
Alignment:
14 cctgtgtaccgtggtgtaagaaagagggattccgggaagtgggtttgcgaagtaagagaacctaacaagaaaaccagaatttggcttggaacattcccta 113  Q
    ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
45888301 cctgtgtaccgtggtgtaagaaaaagggattccgggaagtgggtttgcgaagtaagagaacctaacaagaaaaccagaatttggcttggaacattcccta 45888400  T
114 caccggagatggcggcgcgtgcgcatgatgtcgctgcgattgcactgagaggaaggtctgcttgtcttaactttgctgattctgcttggaagttgccggt 213  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
45888401 caccggagatggcggcgcgtgcgcatgatgtcgctgcgattgcactgagaggaaggtctgcttgtcttaactttgctgattctgcttggaagttgccggt 45888500  T
214 tccggctacgtcggaagcaagggatattcaaaaggcggcggctgaggcagcggaggctttcaggccggag 283  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
45888501 tccggctacgtcggaagcaagggatattcaaaaggcggcggctgaggcagcggaggctttcaggccggag 45888570  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University