View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4163_high_22 (Length: 270)
Name: NF4163_high_22
Description: NF4163
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4163_high_22 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 212; Significance: 1e-116; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 20 - 258
Target Start/End: Complemental strand, 12328038 - 12327799
Alignment:
| Q |
20 |
caccattcatatggatatacttcacctcaagcggaaattactttttgatcacccacgtaatacttgcattgtcgatggcactcaacaccaacataacgtg |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12328038 |
caccattcatatggatatacttcacctcaagcagaaattactttttgatcacccacgtaatacttgcattgtcgatggcactcaacaccaacataacgtg |
12327939 |
T |
|
| Q |
120 |
tcatatgacctccatatttt-ttaaagactttcgatacaatgaatcagacaaatttagtcaaaccatcgactctgatagcactattagttccatcgatca |
218 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| || ||||||||||||||||||||||||||||||||| |
|
|
| T |
12327938 |
tcatatgacctccatattttcataaagactttcgatacaatgaatcagacaaatttagtcaaatcaacgactctgatagcactattagttccatcgatca |
12327839 |
T |
|
| Q |
219 |
acaatcttattgtccgacctcattgtaagaaacacaggtt |
258 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
12327838 |
acaatcttattgtccgacctcgttgtaagaaacacaggtt |
12327799 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University