View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4163_high_34 (Length: 239)
Name: NF4163_high_34
Description: NF4163
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4163_high_34 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 162; Significance: 1e-86; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 162; E-Value: 1e-86
Query Start/End: Original strand, 15 - 228
Target Start/End: Complemental strand, 21778493 - 21778280
Alignment:
| Q |
15 |
agattgagatgattagcatgtatgaggttgtggatattgatttgaaacctggtgtttgtattgatgtccatatcctcatgaagaattaaggattttttca |
114 |
Q |
| |
|
||||||||||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21778493 |
agattgagatgattaacatgtatgaggttgcggatattgatttgaaacctggtgtttgtattgatgtccatatcctcatgaagaattaaggattttttca |
21778394 |
T |
 |
| Q |
115 |
tcaacattaatgnnnnnnnnnnnngaagtctttattgcgttcattaatctaatactctaaattctaaagttatttatatattaagaaaattaataaattt |
214 |
Q |
| |
|
|||||||||||| |||||||||||||| ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21778393 |
tcaacattaatgtttttattttttgaagtctttattgctttcattaatctaatagtctaaattctaaagttatttatatattaagaaaattaataaattt |
21778294 |
T |
 |
| Q |
215 |
ttgctacttttcat |
228 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
21778293 |
ttgctacttttcat |
21778280 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University