View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4163_high_44 (Length: 208)
Name: NF4163_high_44
Description: NF4163
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4163_high_44 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 165; Significance: 2e-88; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 165; E-Value: 2e-88
Query Start/End: Original strand, 14 - 190
Target Start/End: Complemental strand, 36757873 - 36757697
Alignment:
| Q |
14 |
cataggtaaaatgatttttatatctaatgacttaagttttaaggtgaaaataagagtgagaattacttctaatgacttaagttttaggcaatgataatta |
113 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36757873 |
cataagtaaaatgatttttatatctaatgacttaagttttaaggtgaaaataagagtgagaattacttctaatgacttaagttttaggcaatgataatta |
36757774 |
T |
|
| Q |
114 |
agtttgatcacattaaatcatgggtggtttgagaattaagagttacgagaaagaaaatatagggcaagtgatgggat |
190 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||||| |
|
|
| T |
36757773 |
agtttgatcacattaaatcatgggtggtttgagaattaagagttacgagaaagaaaatatagggtaagtaatgggat |
36757697 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University