View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4163_low_3 (Length: 520)
Name: NF4163_low_3
Description: NF4163
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4163_low_3 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 94; Significance: 1e-45; HSPs: 5)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 94; E-Value: 1e-45
Query Start/End: Original strand, 87 - 192
Target Start/End: Complemental strand, 501844 - 501739
Alignment:
| Q |
87 |
aaaatttgtgttgatattataacatggtaattggtcaaaactctgattgagcaagtatatttgtgaatgtgagccattccaaatttgtgttgtactaact |
186 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
501844 |
aaaatttgtgttgatattataacatggtaattggtcaaaactcacattgagcaagtatatttgtgaatgtgagccattccaaatttctgttgtactaact |
501745 |
T |
|
| Q |
187 |
gtcaat |
192 |
Q |
| |
|
|||||| |
|
|
| T |
501744 |
gtcaat |
501739 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 74; E-Value: 1e-33
Query Start/End: Original strand, 15 - 92
Target Start/End: Complemental strand, 501939 - 501862
Alignment:
| Q |
15 |
cagagacaatgtccttatgaagtttccacttctcttgtttctcttccaatgaaatggtatgcaatgtaacacaaaatt |
92 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
501939 |
cagagacaatgtccttatgaagtttccacttctcttgtttctcttccaatgaaatggtatggaatgtaacacaaaatt |
501862 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 262 - 307
Target Start/End: Complemental strand, 501713 - 501668
Alignment:
| Q |
262 |
atgattggaaatggtgatattaagtctaaatcaaatcaaagggaaa |
307 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
501713 |
atgattggaaatggtgatattaagtttaaatcaaatcaaagggaaa |
501668 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 371 - 405
Target Start/End: Complemental strand, 501673 - 501639
Alignment:
| Q |
371 |
gggaaattattttgtaattcttgttttttacattt |
405 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
501673 |
gggaaattattttgtaattcttgttttttacattt |
501639 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #5
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 402 - 433
Target Start/End: Complemental strand, 501566 - 501535
Alignment:
| Q |
402 |
attttgtatttcaaacttgtcaccttgagcta |
433 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
501566 |
attttgtatttcaaacttgtcaccttgagcta |
501535 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University