View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4163_low_33 (Length: 241)
Name: NF4163_low_33
Description: NF4163
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4163_low_33 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 90; Significance: 1e-43; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 90; E-Value: 1e-43
Query Start/End: Original strand, 5 - 98
Target Start/End: Original strand, 44101918 - 44102011
Alignment:
| Q |
5 |
cctgctctcgacacccccacttcccatatttcaagatctttgtgtgatagtatagagcctaattaaataaaatgtggggactcgttgtaatcga |
98 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44101918 |
cctgctctcgacacccccacttctcatatttcaagatctttgtgtgatagtatagagcctaattaaataaaatgtggggactcgttgtaatcga |
44102011 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 148 - 225
Target Start/End: Original strand, 44102059 - 44102136
Alignment:
| Q |
148 |
cattaaagctttgtttggttgatgtggattttctaagggctgattatagccatggtttgtattatgattggtgcaact |
225 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44102059 |
cattaaagctttgtttggttgatgtggattttctaagggctgattatagccatggtttgtattatgattggtgcaact |
44102136 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University