View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4163_low_40 (Length: 237)
Name: NF4163_low_40
Description: NF4163
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4163_low_40 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 18 - 222
Target Start/End: Complemental strand, 34320376 - 34320172
Alignment:
| Q |
18 |
atagcagtggtattgcattcgaagttgtgtagtcaattattcaaaaacttacaaagggtaagtttcaacataaaacttctttcgatggtctttaactaaa |
117 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34320376 |
atagcagtagtattgcattcgaagttgtgtagtcaattattcaaaaacttacaaagggtaagtttcaacataaaacttctttcgatggtctttaactaaa |
34320277 |
T |
|
| Q |
118 |
ctcagttatctatgatagactctaaaatccaatgtcagttcgttaatcttttaatgcagcaatcttcatctgacatgcacaaagactttgatcttttcat |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34320276 |
ctcagttatctatgatagactctaaaatccaatgtcagttcgttaatcttttaatgcagcaatcttcatctgacatgcacaaagactttgatcttttcat |
34320177 |
T |
|
| Q |
218 |
ttcat |
222 |
Q |
| |
|
||||| |
|
|
| T |
34320176 |
ttcat |
34320172 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University