View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4163_low_44 (Length: 220)
Name: NF4163_low_44
Description: NF4163
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4163_low_44 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 153; Significance: 3e-81; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 153; E-Value: 3e-81
Query Start/End: Original strand, 25 - 206
Target Start/End: Original strand, 51756745 - 51756921
Alignment:
| Q |
25 |
gtggtcacagtcgcacatggttccatcaaatggacgatgctaactaaaatgtctgtttcagactcaataacttgtctattgccgaatataacaaattaac |
124 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| ||| |
|
|
| T |
51756745 |
gtggtcacagtcgcacatggttccatcaaatggacgatgctaactaaaatgtctgtttcagactcaataatttgtctattgccgaatataaca----aac |
51756840 |
T |
 |
| Q |
125 |
ttgtaacaccaccagctgacggatgaaatttactgttggtatatactaattgtaataagattcccacaactctacatcagtg |
206 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51756841 |
ttgtaacaccaccagctgacggatgaaatttactgttggta-atactaattgtaataagattcccacaactctacatcagtg |
51756921 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University